Assessment
of Genetic Diversity and Relationships Among Diverse Rice Genotypes using Heading
Date/QTLs Linked SSR Markers
Ashraf M. Elmoghazy1*, Ola A. Galal2,
Salma K. Kelany2 and Said A. Dora2
1Rice Research and Training Center, Field Crops Research Institute,
Agricultural Research Center, 33717, Kafr Elsheikh, Egypt
2Genetics Department, Faculty of Agriculture, Kafrelsheikh University,
33516 Kafr Elsheikh, Egypt
*For correspondence: drashrafmoghazy@gmail.com
Received 19 December
2022; Accepted 23 February 2023; Published 13 April 2023
Abstract
Genetic diversity is the main source for plant
breeder to develop new elite genotypes. The objective of this investigation is
to study phenotypic and molecular genetic diversity among 150 rice (Oryza
sativa L.) genotypes for their heading dates, due to the importance of this
trait in avoiding some climate changes and minimize the water consumption.
Results revealed a wide range of differences for heading dates ranged from 70
to 129 days. Genotypes were classified into four groups; very early, early,
intermediate and late. Four SSR markers linked to heading date trait/QTLs were
used to study 20 selected genotypes. Seventeen polymorphic alleles with
molecular sizes ranged from 108 to 304 bp were amplified. Two out of the four
primers (RM510 and RM585) produced the PCR expected product size (122 and 233
bp, respectively) in addition to other unexpected alleles. The RM585 primer
generated an unexpected additional band with a molecular size of 257 bp. This
band appeared only in five very early and early-dated genotypes and was
completely absent from the intermediate and late genotypes. This primer also
recorded the highest PIC value (0.765). RM7601 also produced an additional
unexpected band with molecular size of 116 bp. This fragment only appeared in
most very early and early heading date genotypes, not in intermediate and late
genotypes. For the cluster analysis based on the SSR markers, the 20 rice
genotypes were divided into two main clusters, which were respectively divided
into three and two groups that matched in heading date. © 2023 Friends Science
Publishers
Keywords: Rice; Heading
date; Genetic variability; SSR markers
Introduction
Rice (Oryza
sativa L., 2n = 24) is the most important staple food crop for more than
3.5 billion people (Xu et al. 2016;
Saleh et al. 2020). It is cultivated
in Egypt over an area of about 660 thousand hectares, with an annual production
of about 4.6 million tons of paddy, with average productivity of 10 tons per
hectare (EAS 2018; Elmoghazy and Elshenawy 2018; FAO 2018). Genetic variability
is the basis of plant breeding as the success of any crop improvement program
depends on the magnitude of genetic variability (Ganapathi et al. 2014; Sarker et al.
2015). The creation of variability in rice germplasm is one of the most
effective methods that provides a wide range of genotypes that can be selected
to develop new varieties with a desired combination of traits (Pandey et al. 2009; Sakran et al. 2022). Moreover, it accelerates the detection of promising
genotypes without the need to evaluate all possible cross combinations in
breeding programs (Palanga et al.
2016). Selection can be effectively practiced only in the presence of
variability of desired traits. The development of early maturing rice genotypes
is of great importance; it could be used to avoid certain climate changes such
as high temperature during fertilization which represent a very serious problem
affecting grain yield. The short duration rice varieties save time for planting
other winter crops, save irrigation water, which represents the main constraint
of rice cultivation and save efforts and expenses of rice cultivation. Heading
date is determined by both genetic factors and environmental conditions (Andres
and Coupland 2012). Cultivars with an appropriate heading date will be
conductive to high grain yield by fully utilizing the light and temperature
resources in their growing regions (Zhang et
al. 2015). In rice, flowering time is regulated by the complex genetic
mechanisms involving hundreds of quantitative trait loci; QTLs (Hori et al. 2016; Matsubara and Yano 2018; Liu
et al. 2021).
DNA-based molecular markers have been used extensively
for studying genetic diversity (Yadav et
al. 2013; Sarif et al. 2020).
Compared with agro-morphological markers, molecular markers are not influenced
by environmental factors and are generally more sensitive to differences among
genotypes at the DNA level, thus increasing their detection efficiency and fast
(Ming et al. 2010). Currently, simple
sequence repeats (SSRs) are the molecular tools used for diversity evaluation
and detecting relationships among different crop species, populations, or
individual rice accessions (Pachauri et
al. 2013; Hoque et al. 2021).
According to Allhgolipour et al.
(2014), SSR markers are suitable for evaluating genetic diversity among closely
related rice accessions. A study of Wang et
al. (2014) has identified that microsatellite loci may be used to detect
genetic variation and genetic relationships within rice through genome study as
well as allelic diversity analysis.
The present investigation aimed to assess the genetic
variability and heritability for heading date trait of 150 different rice
genotypes under Egyptian conditions. Moreover, study of genetic diversity and
phylogenetic relationships; among 20 selected genotypes, based on SSR markers
related to heading date trait/QTLs.
Materials and Methods
The
present study was conducted at Genetics Department, Faculty of Agriculture,
Kafr Elsheikh University, Egypt and Rice Research and Training Center (RRTC),
Sakha, (31°05'36.4"N 30°55'45.6"E and 4m elevation) Kafr Elsheikh, Egypt
during the two summer seasons; 2017 and 2018. The experimental soil is
silty clay and the temperature ranged from 22 to 38℃ (for maximum) and 15 to 28℃ (for minimum) during the
growing season.
Plant material and experimental design
One
hundred fifty rice (Oryza sativa L.) genotypes; six local genotypes
(Giza 177, Giza 178, Sakha 102, Giza 171, NABATAT ASMAR and Egyptian Yasmin)
and 144 exotic genotypes obtained from Egyptian Rice Gene Bank (ERGB) of RRTC,
were used in this study. Names and origins of the 150 studied rice genotypes
are listed in Table 1. All the
150 genotypes were grown in a randomized complete block design (RCBD) in three
replications; each consisting of one row/genotype. Each row was 5 m long and
contained 25 seedlings with 20×20 cm spacing among rows and hills. All standard crop management
were applied as recommended by RRTC (RRTC 2013) and by Elmoghazy and Elshenawy
(2018).
Heading date trait
The
heading date trait was scored according to the International Rice Research Institute
(IRRI) Standard Evaluation System (IRRI 2014). The 150 rice genotypes were classified into four
groups as follows: Genotypes with heading date ranged from 70 to
92 days are very early, from 93 to 110 days are early, from 111 to 120 days are
intermediate and from 121 to 130 days are late.
Molecular analysis
Based on
heading date scoring, 20 genotypes (five genotypes/group) were selected for
molecular characterization using four SSR molecular markers. Genomic DNA was
isolated from 100 mg healthy leaves (three weeks old) of the 20 selected rice
genotypes using CTAB method (Murray and Thompson 1980).
SSR markers and PCR amplification
Four SSR
DNA markers (introduced from Eurofins Genomics Co., Germany); related to
heading date trait/QTLs, were screened on DNA templates. All primer sequences
were directly downloaded from Gramene database (www.gramene.com). Details of
primer sequences, chromosomal locations, repeat motifs and expected product
sizes are given in Table 2. The PCR amplification reaction was performed in 10 μL reaction mixture, containing 1 μL of DNA template (15 ng/μL), 1 μL of each of the forward and reverse primers (10 nmol/μL), 5 μL of 2X PCR master mix (amaROnePCRTM - GeneDireX,
Inc) and 2 μL of double
distilled water (ddH2O).
A thermocycler (TECHNE TC-412) was used to carry out the PCR
amplification programme as follows: an initial denaturation step at 94°C for 5
min, followed by 35 cycles of denaturation at 94°C for 1 min, primer annealing
at 50–55oC for 30 sec and primer extension at 72°C for 1 min. By the
end of the 35th cycle, a final extension step at 72°C for 5 min was
performed. The PCR amplified products were stored at -20°C until use. The PCR amplified fragments were
separated by electrophoresis on 3% agarose gel stained with ethidium bromide,
visualized under a UV transillumination and then photographed using Biometra
gel documentation unit (BioDoc, Biometra, Germany). Molecular size of the
separated fragments was determined against a known DNA ladder (HyperLadderTM
100 bp, Bioline) using Gel Analyzer 10 Program.
Data analysis
Data of
heading date trait was subjected to analysis of variance (ANOVA) for randomized
complete block design (RCBD), by using the statistical analysis software
program MSTAT-C; version 2.10 (MSTAT-C 1991). Based on the combined analysis of
the two studied seasons, the genotypic (GV) and phenotypic (PV) variances,
genotypic (GCV%) and phenotypic (PCV%) coefficient of variations and
heritability in broad sense () were calculated according to
Falconer (1981). Least significant difference (LSD) method was used to compare
means at 5% level of probability. For molecular analysis, data of SSR markers
were introduced as binary values 1 and 0 for the presence and absence of an
amplified band, respectively. Number of alleles was determining and polymorphic
information content of the locus i (PICi) was calculated
according to Roldan-Ruiz et al.
Table 1: The 150 studied rice
genotypes, their country of origins and the mean of combined phenotypic
data for heading date trait over the two seasons, 2017 and 2018 under Egyptian
conditions. These genotypes were obtained from Egyptian Rice Gene Bank,
located at RRTC, Sakha, Egypt. Each genotype was carefully examined and
purified
No. |
Genotype |
Origin |
Heading Date (days) |
1 |
E B
Gopher |
Texas,
United States |
105 |
2 |
PR 325 |
United
States |
108 |
3 |
OwariMochi |
Japan |
120 |
4 |
WC 3777 |
Francisco
Morazán |
114 |
5 |
Tehran |
Iran |
71 |
6 |
Lang
ShweiKeng |
China |
104 |
7 |
BG 79 |
Guyana |
70 |
8 |
D.
Sancho |
Lisboa,
Portugal |
72 |
9 |
Barbado |
Lisboa,
Portugal |
70 |
10 |
Sanakevelle |
Liberia |
124 |
11 |
MARATELLI |
Italy |
73 |
12 |
Chin |
Panama |
115 |
13 |
Italica
Carolina |
Lubelskie,
Poland |
70 |
14 |
Italica
M1 |
Lubelskie,
Poland |
70 |
15 |
Alvario |
Portugal |
75 |
16 |
TAICHUNG
33 |
Taiwan |
114 |
17 |
Romanica |
Pest,
Hungary |
70 |
18 |
Rexora |
Mozambique |
124 |
19 |
IR
334-17-1-3-1 |
IRRI
Philippines |
124 |
20 |
Amber
33 |
Iraq |
119 |
21 |
Giza
177 |
Egypt |
93 |
22 |
Giza
178 |
Egypt |
100 |
23 |
Blue
Rose Sela |
Argentina |
113 |
24 |
Sakha
102 |
Egypt |
101 |
25 |
Bungara |
Rwanda |
115 |
26 |
KhaoHao |
Laos |
120 |
27 |
J.P. 5 |
Pakistan |
108 |
28 |
Nauta |
Loreto,
Peru |
112 |
29 |
P
761-40-2-1 |
Colombia |
113 |
30 |
NEANG
MEAS |
Cambodia |
114 |
31 |
Fa Yiu
Tsai |
Hong
Kong |
116 |
32 |
JambaramVermelho |
Guinea-Bissau |
116 |
33 |
Kathmandu
Valley No.1 |
Nepal |
76 |
34 |
Daudzai |
Pakistan |
129 |
35 |
Thangone |
Laos |
111 |
36 |
PrataoPrecoce |
Brazil |
109 |
37 |
Precocinho |
Brazil |
109 |
38 |
Imbolo
II |
Congo |
110 |
39 |
Onu B |
Congo |
115 |
40 |
Shima |
Iraq |
116 |
41 |
Giza
171 |
Egypt |
113 |
42 |
P 1289 |
Turkey |
112 |
43 |
CH
242-32 |
Biobío,
Chile |
109 |
44 |
HalwaGose
Red |
Iraq |
113 |
45 |
MIYANG |
China |
107 |
46 |
Zira |
Kenya |
113 |
47 |
MEDUSA |
Lombardia,
Italy |
119 |
48 |
HD14 |
Australia |
112 |
49 |
Gidej |
Azerbaijan |
115 |
50 |
Grassy |
Haiti |
113 |
51 |
B459A1-49-1-2-1 |
Texas,
United States |
112 |
52 |
Dular |
Dhaka,
Bangladesh |
115 |
53 |
Cesariot |
Occitanie,
France |
113 |
54 |
CIGALON |
France |
113 |
55 |
IR
2061-214-2-3 |
IRRI Philippines |
120 |
56 |
Precoz
de Machiques |
Aragua,
Venezuela |
71 |
57 |
Sesilla |
Bulgaria |
122 |
58 |
WC 3398 |
Nayarit,
Mexico |
108 |
59 |
B441B-24-4-5-1 |
Indonesia |
123 |
60 |
Quinimpol |
Philippines |
119 |
Table 1: Continue
Table
1: Continue
61 |
WC 3395 |
Jamaica |
117 |
62 |
Sadri Type |
Iraq |
119 |
63 |
Criollo |
Mexico |
119 |
64 |
PuangNigern |
Thailand |
120 |
65 |
Daido |
Mongolia |
73 |
66 |
Natapasume |
Taiwan |
119 |
67 |
Rz No.
111 |
Congo |
114 |
68 |
Apure |
Aragua,
Venezuela |
119 |
69 |
WC 2810 |
Pohnpei,
Micronesia |
120 |
70 |
Ao Chiu
2 Hao |
Sichuan
Sheng, China |
119 |
71 |
AgulhaBranco |
El
Salvador |
117 |
72 |
MataoLizo |
El
Salvador |
117 |
73 |
Secano
do Brazil |
El
Salvador |
115 |
74 |
ItalicaAlef |
Former,
Soviet Union |
73 |
75 |
NABATAT
ASMAR |
Giza,
Egypt |
121 |
76 |
LOMELLO |
Italy |
73 |
77 |
I KUNG
PAO 5-3-4 |
Taiwan |
115 |
78 |
AP 439 |
Venezuela |
115 |
79 |
Aguja |
Bolivia |
115 |
80 |
Cola de
Burro |
Bolivia |
112 |
81 |
Mojito
Colorado |
Bolivia |
116 |
82 |
Campino |
Portugal |
114 |
83 |
Laat |
Suriname |
114 |
84 |
MONTICELLI |
Lazio,
Italy |
76 |
85 |
STIRPE
82 CHIAPPELLI |
Piemonte,
Italy |
76 |
86 |
KamBauNgan |
Hong
Kong |
76 |
87 |
IguapeCateto |
Săo Paulo,
Brazil |
115 |
88 |
MUTSU
HIKARI |
Aomori,
Japan |
76 |
89 |
JUMA 1 |
Dominican
Republic |
123 |
90 |
KhaoKhao |
Thailand |
121 |
91 |
NAYIMA
45 |
Iraq |
117 |
92 |
IARI
7449 |
Assam,
India |
113 |
93 |
Agbede |
Nigeria |
116 |
94 |
Sika |
Cameroon |
123 |
95 |
KhaoPhoi |
Laos |
113 |
96 |
KhaoLuang |
Laos |
115 |
97 |
NIQUEN |
Biobío,
Chile |
73 |
98 |
IR
1614-168-2-2 |
Philippines |
122 |
99 |
Basmati
Sufaid |
Punjab,
Pakistan |
109 |
100 |
Chak 48 |
Punjab,
Pakistan |
117 |
101 |
B35 |
Punjab,
Pakistan |
122 |
102 |
DhanSufaid |
Punjab,
Pakistan |
118 |
103 |
Jhona |
Punjab,
India |
112 |
104 |
P 79 |
Colombia |
110 |
105 |
Ratua
Red Nehri |
Punjab,
Pakistan |
118 |
106 |
GPNO
19314 |
Brazil |
118 |
107 |
Choei-ine |
Japan |
72 |
108 |
GPNO
16379 |
Pohnpei,
Micronesia |
72 |
109 |
Chao
Hay b |
Laos |
109 |
110 |
Glutinous |
Hong
Kong |
111 |
111 |
TJ |
Guyana |
74 |
112 |
Ambalalava
1283 |
Madagascar |
74 |
113 |
PD 46 |
Sri Lanka |
74 |
114 |
IacaEscuro |
Guinea |
119 |
115 |
PATNAI
6 |
Yangon,
Myanmar |
119 |
116 |
BIRIBRA |
Ghana |
76 |
117 |
WW
3/200 |
Netherlands |
115 |
118 |
Subdesvauxii
Vase |
Portugal |
115 |
119 |
E.
Yasmine |
Egypt |
120 |
120 |
HON
CHIM |
Hong
Kong |
76 |
121 |
MAKALIOKA
752 |
Madagascar |
116 |
122 |
COLOMBIA
1 |
Colombia |
112 |
123 |
Batatais |
Brazil |
115 |
124 |
R 29/1 |
Congo |
115 |
125 |
R 98 |
Congo |
116 |
126 |
R 98/1 |
Congo |
110 |
127 |
R 99/3 |
Congo |
110 |
Table 1: Continue
Fig. 1: Profiles of DNA amplified
fragments generated by RM223, RM510, RM585 and RM7601 markers for the 20 rice
genotypes selected based on heading dates. M: 100 bp DNA ladder. Genotypes 1-5
(very early): BG 79, Barbado, Italica Carolina, Italica M1 and Romanica.
Genotypes 6-10 (early): Giza 177, Giza 178, Sakha 102, Lang ShweiKeng and E B Gopher.
Genotypes 11-15 (intermediate): KhaoHao, IR 2061-214-2-3,
PuangNigern, WC 2810 and Mack Khoune.
Genotypes 16-20 (late): GPNO 22236, Sanakevelle,
Rexora, IR 334-17-1-3-1 and Daudzai
Table 1: Continue
128 |
Nema |
Iraq |
118 |
131 |
GPNO
22236 |
Kankan,
Guinea |
123 |
132 |
IM 16 |
Nigeria |
111 |
133 |
ECIA76-S89-1 |
Cuba |
111 |
134 |
TAKAO
11 |
Taiwan |
117 |
135 |
WC 1006 |
Iraq |
117 |
136 |
Rubra |
Former,
Soviet Union |
116 |
137 |
LATE
CALORO |
Australia |
122 |
138 |
TrionfoFassone |
Piemonte,
Italy |
114 |
139 |
YabaniMontakhab
57 |
Odisha,
India |
116 |
140 |
Precosur |
Entre
Ríos, Argentina |
111 |
141 |
IR
773A1-36-2-1-3 |
Philippines |
121 |
142 |
IARI
5753B |
Assam,
India |
115 |
143 |
Mack
Khoune |
Laos |
120 |
144 |
H64-9-1 |
Argentina |
119 |
145 |
Mabla |
Punjab,
Pakistan |
110 |
146 |
GPNO
29157 |
Jiangsu
Sheng, China |
119 |
147 |
Hae Zo |
Korea,
South |
119 |
148 |
Vary
TarvaOsla |
Portugal |
75 |
149 |
CHONTALPA
437 |
Mexico |
115 |
150 |
Sathi
Basmati |
Punjab,
Pakistan |
122 |
|
Average |
|
107 |
|
Max |
|
129 |
|
Min |
|
70 |
|
Stander
Deviation |
|
17.02 |
|
Stander
Error |
|
1.39 |
(2000) as
follows: PICi = 2fi(1-fi); Where fi represents the
frequency of the present bands and (1-fi) is the frequency of the absent
bands. The PIC value of each primer was calculated using the average PIC values
for all primer.
To determine the genetic relationships
among the 20 selected rice genotypes, a dendrogram was constructed based on
Jaccard's similarity coefficient (Jaccard 1901) using the Unweighted Pair-Group
Method with Arithmetic mean (UPGMA) analysis (Nei 1973).
Results
Analysis of variance for heading date trait
Based on the combined
data, analysis of variance represented in Table 3 showed highly significant
differences among the 150 studied rice genotypes and between 2017 and 2018
seasons for heading date trait. Highly significant differences were also found
for the interaction between genotypes and years. Significance of genotype mean
squares revealed that there are genetic differences among genotypes in case of
heading date trait. The existence of genetic variability is the key component
of breeding programs for broadening the gene pool to develop high yielding
varieties (Aditya and Bhartiya 2013; North 2013).
Mean performance and heading date scoring
The mean performance
of heading date trait was scored for the 150 studied genotypes (Table 1). A wide range of differences was observed
among genotypes with mean performance values ranged from 70 days (BG79,
Barbado, Italica Carolina, Italica M1 and Romanica genotypes) to 128 days
(Daudzai genotype). Results of heading
date scoring indicated that the majority of studied genotypes heading date was belonging
to the intermediate group including 87 genotypes of the 150 studied genotypes,
while the minority was to late group of heading date by 16 genotypes. Mean performance of heading
date for the 20 rice genotypes (five genotypes/group) which were selected for
molecular characterization on the basis of their heading date estimates are listed in Table 4.
Molecular characterization
Polymerase chain
reactions for RM223, RM510, RM585 and RM7601 SSR markers; which were reported
to be linked to heading date trait/QTLs, were carried out with DNA templates of
the 20 selected genotypes. Genotypic screening of the 20 genotypes with the
four SSR markers are presented in Fig. 1 and Table 5.
Table 2: Forward (F) and
reverse (R) primer sequences, chromosomal locations (CL), repeat motifs,
annealing temperature and expected PCR product sizes of the used four SSR
markers
Primer |
F/R Primer 5'→3' |
CL |
Repeat motif |
Annealing temperature
(şC) |
Expected product size
(bp) |
References |
RM223 |
F -GAGTGAGCTTGGGCTGAAAC |
8 |
(CT)25 |
55 |
165 |
Khatab et al. (2016) |
R- GAAGGCAAGTCTTGGCACTG |
||||||
RM510 |
F- AACCGGATTAGTTTCTCGCC |
6 |
(GA)15 |
55 |
122 |
Khatab et al. (2016) |
R- TGAGGACGACGAGCAGATTC |
||||||
RM585 |
F- CAGTCTTGCTCCGTTTGTTG |
6 |
(TC)45 |
55 |
233 |
Khatab et al. (2016) |
R- CTGTGACTGACTTGGTCATAGG |
||||||
RM7601 |
F -GCCTCGCTGTCGCTAATATC |
7 |
(TGGA)7 |
50 |
133 |
Fatimah et al. (2014) |
R-CAGCCTCTCCTTGTGTTGTG |
-groups, IIa and IIb, which
contain the most late genotypes
All SSR fragments were
determined and a high level of polymorphism (100%) was observed suggesting a
high level of diversity among the used genotypes. The PIC (Polymorphic
Information Content) values
ranged from 0.418 (RM510) to 0.765 (RM585) with an average of 0.559 per marker
(Table 6). Accordingly, primer RM585 was the most polymorphic primer while it
produced a total of six alleles with different molecular sizes and also
recorded the highest PIC value (0.765).
Table 3: Mean squares of heading
date trait based on the combined data of the two studied seasons; 2017 and 2018
Source of variation |
Degree of freedom |
Mean square |
Years |
1 |
327.610** |
Rep/Year |
4 |
0.262 |
Genotypes |
149 |
1738.428** |
Genotypes ×Years |
149 |
21.760** |
Error |
596 |
6.125 |
** Significant differences
at 1% level of probability
Table 4: Mean, genotypic and
phenotypic variances, genotypic and phenotypic coefficients of variation, and
heritability in broad sense for heading date trait for the 150 studied
genotypes
Parameter |
Heading
date |
Mean
(days) |
107.22 |
Genotypic
variance (GV) |
288.72 |
Phenotypic
variance (PV) |
294.82 |
Genotypic
coefficient of variation (GCV %) |
15.85 |
Phenotypic
coefficient of variation (PCV %) |
16.01 |
Heritability
(%) |
97.93 |
Table 5: Mean performance of heading
date trait for the 20 selected rice genotypes
S. No. |
Genotype |
Heading date (days) |
Group |
1 |
BG 79 |
70 |
Vary early |
2 |
Barbado |
70 |
Vary early |
3 |
Italica Carolina |
70 |
Vary early |
4 |
Italica M1 |
70 |
Vary early |
5 |
Romanica |
70 |
Vary early |
6 |
Giza 177 |
93 |
Early |
7 |
Giza 178 |
99 |
Early |
8 |
Sakha 102 |
100 |
Early |
9 |
Lang ShweiKeng |
103 |
Early |
10 |
E B Gopher |
105 |
Early |
11 |
KhaoHao |
119 |
Intermediate |
12 |
IR 2061-214-2-3 |
119 |
Intermediate |
13 |
PuangNigern |
119 |
Intermediate |
14 |
WC 2810 |
119 |
Intermediate |
15 |
Mack Khoune |
120 |
Intermediate |
16 |
GPNO 22236 |
123 |
Late |
17 |
Sanakevelle |
123 |
Late |
18 |
Rexora |
124 |
Late |
19 |
IR 334-17-1-3-1 |
124 |
Late |
20 |
Daudzai |
129 |
Late |
A total of 17 fragments with an average of 4.25 alleles/marker were amplified
in the present study. Alleles molecular size varied from 108 to 304 bp among
the 20 genotypes. Multiple
PCR amplicons ranged from 3 for RM510 and RM7601 to 6 for RM585 were yielded.
The amplified number of alleles were varied among genotypes from 3
to 5 alleles. The
three SSR primers; RM223, RM510 and RM585, produced PCR bands in all the
studied genotypes, while RM7601 primer did not amplify any bands in Khao Hao (intermediate genotype) and IR 334-17-1-3-1 (late
genotype) (Fig. 1 and Table 6).
Out of the four SSR markers, two primers (RM510 and
RM585) produced the PCR expected product sizes, 122 and 233 bp, respectively,
in addition to other unexpected alleles. On the other hand, the other two
primers; RM223 and RM7601, had several unexpected alleles ranging from 3
alleles of molecular size 108, 116 and 125 bp for RM7601 to 5 alleles of
molecular size ranging from 136 to 304 bp for RM223 but did not produce an
allele of the expected size.
Cluster analysis
Based on molecular data of
SSR markers linked to heading date trait/QTLs, Jaccard's similarity
coefficients were calculated and a dendrogram was constructed using the UPGMA
method to determine the genetic relationships among the 20 rice genotypes (Fig.
2). The dendrogram showed a clear separation of the 20 rice genotypes into two
main clusters (I and II) at a genetic similarity of 9.0%. The first cluster (I)
included 15 genotypes which were divided into three groups (Ia, Ib and Ic).
Group Ia had two late heading date genotypes (Sanakevelle and IR 334-17-1-3-1).
The seven genotypes in group Ib were divided into two sub-groups at a genetic
similarity of 47.8%. The first one (Ib-1) contained four genotypes; with 100%
genetic similarity, which were very early (Italica M1 and Romanica) and early
(Giza 178 and Sakha 102) for heading date trait. However, the other three very
early genotypes (BG 79, Barbado and Italica Carolina) were separated in the
second sub-group Table 6: Genotypic screening of the 20 selected rice
genotypes (based on heading dates) for the used four SSR markers; RM223, RM510,
RM585 and RM7601. + and -, means presence and absence of respected allele,
respectively. Some alleles were amplified only at very early and early heading
genotypes like 304 bp of RM223 and 116 bp of RM 7601 while other alleles were
found only at intermediate and late genotypes like 266 bp and 136 bp of RM223,
122 bp of RM510, 261 bp, 223 bp and 208 bp of RM585 and 125 bp of RM7601. R2 values were highly
significant, which mean high association of the used markers to the trait
Primer |
Expected size (bp) |
Presented alleles (bp) |
Range of size (bp) |
Number of alleles |
Genotypes |
PIC value and R2 |
|||||||||||||||||||
Very early genotypes |
Early genotypes |
Intermediate genotypes |
Late genotypes |
||||||||||||||||||||||
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
13 |
14 |
15 |
16 |
17 |
18 |
19 |
20 |
|
|||||
BG 79 |
Barbado |
Italica Carolina |
Italica M1 |
Romanica |
Giza 177 |
Giza 178 |
Sakha 102 |
Lang ShweiKeng |
E B Gopher |
KhaoHao |
IR 2061-214-2-3 |
PuangNigern |
WC 2810 |
Mack Khoune |
GPNO 22236 |
Sanakevelle |
Rexora |
IR 334-17-1-3-1 |
Daudzai |
||||||
RM223 |
165 |
304 |
168 |
5 |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
0.503 0.002 |
266 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
|||||
154 |
- |
- |
- |
- |
- |
+ |
- |
- |
+ |
+ |
- |
+ |
+ |
+ |
- |
- |
- |
+ |
- |
- |
|||||
148 |
+ |
+ |
+ |
+ |
+ |
- |
+ |
+ |
- |
- |
- |
- |
- |
- |
+ |
+ |
+ |
- |
+ |
- |
|||||
136 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
|||||
RM510 |
122 |
130 |
14 |
3 |
- |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
- |
- |
+ |
+ |
+ |
- |
+ |
- |
+ |
- |
0.418 0.002 |
122 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
+ |
- |
- |
- |
+ |
- |
+ |
- |
+ |
|||||
116 |
+ |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
|||||
RM585 |
233 |
261 |
61 |
6 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
- |
- |
- |
0.765 0.0003 |
257 |
- |
- |
- |
+ |
+ |
+ |
+ |
+ |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
|||||
233 |
+ |
+ |
+ |
- |
- |
- |
- |
- |
+ |
+ |
- |
- |
+ |
- |
- |
- |
- |
- |
- |
- |
|||||
223 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
+ |
- |
- |
- |
- |
- |
|||||
208 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
+ |
+ |
- |
+ |
+ |
|||||
200 |
- |
+ |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
- |
- |
- |
+ |
- |
- |
|||||
RM7601 |
133 |
125 |
17 |
3 |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
+ |
0.549 0.0004 |
116 |
+ |
+ |
+ |
+ |
+ |
- |
+ |
+ |
+ |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
- |
|||||
108 |
- |
- |
- |
- |
- |
+ |
- |
- |
- |
+ |
- |
+ |
+ |
+ |
+ |
+ |
+ |
+ |
- |
- |
(Ib-2). Group Ic
contained six genotypes which differed in their heading dates, including three early
genotypes (Giza 177, E B Gopher and Lang Shwei Keng) and three intermediate
genotypes (Puang Nigern, WC 2810 and Mack Khoune). These six genotypes in group
Ic were separated from the other nine genotypes (groups Ia and Ib) at
similarity percentage of 26.2%. Cluster II included five genotypes; represented
the intermediate and late heading date genotypes, which were classified into
two groups; IIa and IIb, with 23.4% similarity. The first group (IIa) consisted
of the two genotypes; KhaoHao (intermediate) and Daudzai (late), while the
second group (IIb) included three rice genotypes; the intermediate genotype (IR
2061-214-2-3) and the two late genotypes (GPNO 22236 and Rexora).
Discussion
Understanding of
genetic variability nature of a trait is very important for plant breeder to
know the role of environment in the expression of this trait. Thus, genetic
variability of heading date trait was determined on the basis of the results of
combined analysis of the two seasons; 2017 and 2018 indicating real differences
between the studied genotypes and wide genetic base to select the superior
genotypes for crossing and selection. Similar findings were reported by (Elgamal
2019; Al-daej et al. 2023). The genetic parameters: such
as variance components (GV and PV), coefficients of variation (GCV and PCV) has
a narrow difference and the estimate of PV was slightly higher than GV.
Regarding GCV and PCV parameters, the GCV value was close to PCV value, as well
as high estimates of heritability in broad sense () indicating that, the heading date trait has less
affected by environment. Heading date trait is under genetic control, selection
would be successful based on phenotypic performance. These results agree with
those of (Ahmadikhah
2010; Mallimar et al.
2015; Rashid et al. 2017; Gyawali et
al. 2018).
From molecular genetics point of view, it was of great
interest to notice that RM223 primer did not produce the expected size band of
165 bp in any of the used genotypes, but was able to produce two distinct unexpected
bands with molecular sizes of 148 and 154 bp. The two unexpected bands were
appeared in both early and late genotypes under study. Therefore, this primer
does not play any role for heading date trait in the used rice genotypes.
For RM510 primer, it also generated an important
unexpected band with molecular sizes of 130 bp, but it does not play any role
for heading date trait while it was present in all the four heading date
groups. On the other hand, this primer generated the expected size band of 122
bp which was appeared in five genotypes belonging to the intermediate (KhaoHao and IR
2061-214-2-3) and late (GPNO 22236, Rexora and Daudzai) genotypes.
Therefore, this fragment could be considered as a good marker for the
intermediate and late rice genotypes for heading date trait.
Primer RM585 was of great interest in this study, it
was able to generate the expected size band of 233 bp in three very early genotypes (BG 79, Barbado and Italica
Carolina), two early genotypes (Lang ShweiKeng and E B
Gopher) and one intermediate genotype (Puang Nigern). On
the other hand, this primer generated an additional unexpected band with
molecular size of 257 bp which was appeared only in five genotypes belonging to
the very early (Italica M1 and Romanica) and early (Giza 177, Giza 178 and
Sakha 102) genotypes
and did not appear in the intermediate and late rice genotypes. Also, another
additional unexpected band with molecular size of 208 bp was amplified only in the
intermediate (IR 2061-214-2-3) and late (GPNO 22236, Sanakevelle, IR
334-17-1-3-1 and Daudzai) genotypes for heading date trait. These results proved that
this primer is considered very important for studying heading
date earliness in rice. Moreover, this primer is considered
the best one for evaluation of heading date trait in rice breeding programs (Khatab et al. 2016; Weerasinghe et al. 2022),
while it was able to produce the highest number of polymorphic alleles (6
alleles) and also recorded the highest PIC value (0.765).
Fig.
2: The
UPGMA dendrogram derived from four SSR markers; linked to heading date, showing
genetic relationships among the selected 20 rice genotypes based on similarity
indices. The studied rice genotypes were divided into two main groups I and II
with genetic similarity of 9%. Group I contained 15 genotypes which divided
into two sup-groups Ia and Ib, this group contain most very early, early and
intermediate genotypes. The group II was divided also to two sup-groups, IIa
and IIb, which contain the most-late genotypes
For RM7601 primer, it proved to be very important for
heading date studies in the used rice genotypes. It failed to produce the
expected size fragment of 133 bp, but was able to produce another additional
unexpected band with molecular size of 116 bp. It was surprised that this
fragment was appeared only in all the five genotypes of very early group (BG 79, Barbado, Italica
Carolina, Italica M1 and Romanica) in addition to three early
genotypes (Giza 178, Sakha 102 and Lang ShweiKeng), but was completely absent
in the intermediate and late genotypes under study. This fragment may play an
important role in the very early and early heading date genotypes under study.
Producing more alleles than the expected; using SSR primers, was previously reported
by (Galal et al. 2014; Aboulila
and Galal 2019).
Finally, we recommend in further study that both
unexpected DNA fragments with molecular sizes of 257 and 116 bp which were only
generated in the very early and early genotypes by RM585 and RM7601 SSR primers,
respectively, should be isolated, sequenced and compared with the heading date
responsible genes in rice gene banks.
Interestingly, the
intermediate and late genotypes were closely related and placed in the same
cluster (cluster II) suggesting that these genotypes were grouped according to
their gene pools. The same trend was observed for the other two groups of
genotypes, which separated in group Ia, and also group Ib which included seven
genotypes (early or very early) in two sub-groups. Thus, there was a close
relationship among the seven genotypes which clustered in group Ib with a
similarity percentage of 47.8%. These results were supported by (Dutta et al.
2011; Khatab et al. 2016; Galal and
Aboulila 2018; Elgamal 2019). They showed that the phylogenetic analysis; based
on SSR markers, grouped the genotypes belonging to the same gene pool in the
same clusters. Thus, SSR markers were useful for studying the genetic diversity
and defining the genetic relationships among rice genotypes. In this respect,
SSR molecular markers have been extensively used for identifying and
characterizing of gene(s) linked to important traits (Wang et al. 2012; Salah et al.
2021) and phylogenetic relationship and genetic diversity analysis among rice
genotypes (Das et al. 2013; Babu et al. 2014; Filiz et al. 2018). This allows fast screening at an early stage of
growth; independent of environmental conditions, that consequently speed up
breeding (Tester and Langridge 2010; Weerasinghe et
al. 2022).
Thus, these markers have proven to be the choice for marker-assisted selection
(MAS) in rice breeding programs.
Conclusion
Heading
date is one of the serious aspects determining regional and seasonal adaptation
for climate changes and has been a main target of selection in rice breeding
programs. Some rice genotypes were used to study phenotypic and molecular
diversity. High amount of diversity was detected among genotypes by both
morphology and molecular markers. The ssr
markers produced some alleles which were specific to heading date in most
screened genotypes; those markers could be used as MAS for rice cultivar
identification and associated with heading date.
Acknowledgement
No Acknowledgement
Author Contributions
The authors were contributed equally in this research and
preparation of the paper
Conflicts of Interest
No conflict of interest concerning this research
References
Andres F, G Coupland (2012). The genetic basis of
flowering responses to seasonal cues. Nat
Rev Genet 13:627‒639
Ahmadikhah A (2010). Study on selection effect, genetic
advance and genetic parameters in rice. Ann
Biol Res 1:45‒51
Pachauri V, N Taneja, P Vikram, NK Singh, S Singh (2013). Molecular and morphological
characterization of Indian farmers rice varieties (Oryza sativa L.). Aust J Crop Sci 7:923‒932
Palanga KK, K Traore, K Bimpong, M Jamshed, MAP Mkulama (2016). Genetic diversity studies on selected
rice varieties grown in Africa based on aroma, cooking and eating quality. Afr J Biotechnol 15:1136‒1146
Wang CH, XM Zheng, Q Xu,
XP Yuan, L Huang, HF Zhou, XH Wei, S Ge (2014). Genetic diversity and
classification of (Oryza sativa L.) with emphasis on Chinese rice
germplasm. Heredity 112:489‒496
Weerasinghe WDP, NT Prathapasinghe,
GDA Priyantha (2022). Evaluation of morphological variations in exotic rice (Oryza Sativa L.) genetic materials under
Sri Lankan field conditions. New Countryside
1:16‒22
Zhang J, X Zhou, W Yan, Z
Zhang, L Lu, Z Han, H Zhao, H Liu, P Song, Y Hu, G Shen, Q He, S Guo, G Gao, G
Wang, Y Xing (2015). Combinations of the Ghd7, Ghd8 and Hd1 genes
largely define the ecogeographical adaptation and yield potential of cultivated
rice. New Phytol 208:1056‒1066